Java 2

Save Time On Research and Writing
Hire a Pro to Write You a 100% Plagiarism-Free Paper.
Get My Paper

One of the key features of Java OOP is to use external class files without knowing much of the implementations. The attached RandomSeq.class file contains the implementation of a RandomSeq class which contain two methods:

    String RandomSeq.getRandomSeq(long arg0) -will return a String of randomly generated DNA sequence of any length passed in as a parameter, and
    void RandomSeq.formatSeq(int arg0) – will print out a formatted DNA sequence with specified length for each line as shown below:

 

   1 GACTTGCCAGTTTAATAATGTCACATAATCAGATACGTAGATTCGCTTAT

Save Time On Research and Writing
Hire a Pro to Write You a 100% Plagiarism-Free Paper.
Get My Paper

  51 ATGCCCGGCCCACTGACGGAGGGGCCCGGGGGTCCAGCCCATGGGGCAGA

 101 GGGACACTCTGAACGCTCGCGCAGGTACGTGTGGTAAACCGATATCGCGC

 151 TTCTACTGACTCTCCCACTCAACGAAGACAAGACTTTGGCCACTCACCCG

 201 GCATTACTATAGCTCGGTGCAGGGAGTCCTCAGCCCCGCGATGGATATTA

 251 GGCTGGCCCCTAACCTGCGAGGACATTCAAAGTAGGTTTTGACCGGCATT

 301 GCAAGGTCACTGAGGAGAATTTATGATAGCCGCCCATACC

The RandomSeq class also has two properties (id and seq) which has the set/get methods of setSeqID(String arg0), setSeq(String arg0), and getSeqID(), getSeq().

Please note, when a DNA sequence String was generated using the getRandomSeq() method, the sequence need to be assigned to the object using the setSeq(String arg0) method. After that, the formatSeq() method can be used to print out the formatted sequence.

Please create a testing Java program to use this RandomSeq class to create a random DNA sequence and then print it out in a formatted fashion with a specified length for each line.
Note: if you use NotePad to create your project, you can simply copy the RandomSeq.class attached file into the same folder of your testing Java program. If you use Eclipse or NetBeans, you probably need to create an external class folder for your project and then import the RandomSeq.class file into the class folder.

Here is how to add the RandomSeq.class file to your project in NetBeans and Eclipse: (assume the RandomSeq.class file is saved into C:\BIFS618)

NetBeans: Create the project first, and then right click on the Libraries from the Projects window, and select Add JAR/Folder to open the window. Browse to the folder contains the .class file (c:\BIFS618), click open. Now the folder is added to the Libraries, and you can create a RandomSeq object directly in your project.

Eclipse: Create the project first, and then right click on the project to select properties. In the properties window, select Libraries tab, and click on Add External Class Folder to select the folder contains the RandomSeq class file and click OK. Now you can use the RandomSeq class directly in your project.

Calculate the price
Make an order in advance and get the best price
Pages (550 words)
$0.00
*Price with a welcome 15% discount applied.
Pro tip: If you want to save more money and pay the lowest price, you need to set a more extended deadline.
We know how difficult it is to be a student these days. That's why our prices are one of the most affordable on the market, and there are no hidden fees.

Instead, we offer bonuses, discounts, and free services to make your experience outstanding.
How it works
Receive a 100% original paper that will pass Turnitin from a top essay writing service
step 1
Upload your instructions
Fill out the order form and provide paper details. You can even attach screenshots or add additional instructions later. If something is not clear or missing, the writer will contact you for clarification.
Pro service tips
How to get the most out of your experience with Homework Mules
One writer throughout the entire course
If you like the writer, you can hire them again. Just copy & paste their ID on the order form ("Preferred Writer's ID" field). This way, your vocabulary will be uniform, and the writer will be aware of your needs.
The same paper from different writers
You can order essay or any other work from two different writers to choose the best one or give another version to a friend. This can be done through the add-on "Same paper from another writer."
Copy of sources used by the writer
Our college essay writers work with ScienceDirect and other databases. They can send you articles or materials used in PDF or through screenshots. Just tick the "Copy of sources" field on the order form.
Testimonials
See why 20k+ students have chosen us as their sole writing assistance provider
Check out the latest reviews and opinions submitted by real customers worldwide and make an informed decision.
Technology
Thank you for your work
Customer 452551, October 22nd, 2021
Finance
Thank you very much!! I should definitely pass my class now. I appreciate you!!
Customer 452591, June 18th, 2022
Psychology
Thank you. I will forward critique once I receive it.
Customer 452467, July 25th, 2020
Business Studies
Great paper thanks!
Customer 452543, January 23rd, 2023
Political science
I like the way it is organized, summarizes the main point, and compare the two articles. Thank you!
Customer 452701, February 12th, 2023
Political science
Thank you!
Customer 452701, February 12th, 2023
Education
Thank you so much, Reaserch writer. you are so helpfull. I appreciate all the hard works. See you.
Customer 452701, February 12th, 2023
Psychology
I requested a revision and it was returned in less than 24 hours. Great job!
Customer 452467, November 15th, 2020
Accounting
Thank you for your help. I made a few minor adjustments to the paper but overall it was good.
Customer 452591, November 11th, 2021
11,595
Customer reviews in total
96%
Current satisfaction rate
3 pages
Average paper length
37%
Customers referred by a friend
OUR GIFT TO YOU
15% OFF your first order
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Claim my 15% OFF Order in Chat
Show more
<
Live Chat 1 7633094299EmailWhatsApp

Order your essay today and save 15% with the discount code WELCOME